Имате резултате генетског тестирања и шта даље?

18. јула 2012.

коментара: 2

Портал Порекло отвара своје странице за генетичку генеалогију, у оквиру које ћемо, између осталог, формирати базу података досад тестираних људи са ових простора. У свом другом, уводном тексту, наш сарадник Синиша Јерковић из Бања Луке упознаје вас са основама генетске генеаологије и даје упуство како да тумачите добијене резултате тестирања вашег генетског порекла

 

Шта је генетска генеалогија?

Иако постоје четири типа генетско-генеалошких тестова данас – аутосомални ДНК тест, X-ДНК тест, Y-ДНК тест и mtДНК тест ми ћемо овдје говорити само о Y-DNК тестовима, које могу тестирати само мушкарци и који истражују или STR (short tandem repeats) или SNP (single nucleotide polymorphisms) на Y хромозому. За STR тест, мјере се кратки сегменти ДНК. Број понављања у том кратком сегменту се мијења током времена, и те промјене се преносе са оца на сина. STR анализа даје хаплотип особе која се тестирала, који се користи да би се процјенила хаплогрупа тестираног. SNP тест истражује промјене у једном нуклеотиду у секвенци ДНК и обично се користи да се одреди тачна хаплогрупа тестираног.

Шта није генетичка генеалогија?

Иако је генетска генеалогија поучна допуна за било чије породично стабло, она није без ограничења.

Свако ко се одлучи на генетско тестирање требао би бити свјестан сљедећег:

1. Резултати генетског теста не укључују и дефинисање породичног стабла. Генетска генеаологија је само допуна традиционалном генеалошком истраживању, а не замјена.

2. Иако се Y-ДНК може користити за одређивање генетске блискости појединаца , не може тачно одредити у ком степену сродства су анализиране особе.

3. На крају, генетски тест открива само мали проценат вашег генома, значи само једну линију предака

Ипак, и поред ових ограничења, генетска генеаологија може бити информативан, користан и узбудљив додатак традиционалном истраживању и може послужити да се открију специфичне генеалошке мистерије. Постоје многе успјешне генеалошке приче које су рјешене уз помоћ генетског тестирања.

Како да тумачим моје Y-ДНК резултате?

STR тестирање

Претпоставимо да сте наручили тестирање STR теста на 12 маркера без SNP теста. То је уједно најчешћи тип тестирања. Стижу вам резултати као серија маркера и њима припадајућих вриједности као у сљедећем примјеру:

Table 1. Sample Y-DNA STR Results

DYS# 393 390 19 391 385a 385b 426 388 439 389-1 392 389-2

Alleles 13 24 14 10 11 14 12 12 12 13 13 29

Шта значе ови бројеви? На свакој од ових локација на Y хромозому постоји потенцијал за неку варијацију (понављање исте секвенце ДНК). На примјер на DYS 426 варијација се састоји од 7 до 18 понављања ДНК секвенце „GTT“ са 12 као најуобичајенијим понављањем . Секвенца ће изгледати овако са 12 понављања који су болдирани

…TGTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGAC…

Неко са резултатом 7 на DYS426 ће имати сљедећу секвенцу:

…TGTGTTGTTGTTGTTGTTGTTGTTGAC…

Заједно, појединачни алели откривени тестирањем представљају твој лични хаплотип.

Користећи наш примјер хаплотипа покушаћемо да 1) одредимо хаплогрупу овог Y- ДНК примјера 2) истражимо пронађену хаплогрупу 3) нађемо подударања у Y-ДНК бази анализираних хаплотипова

1) Којој хаплогрупи овај примјер Y- ДНК најближе припада

За предвиђање хаплогрупа најједноставније је користити неке од постојећих предиктора хаплогрупа који се могу наћи на интернету.

Један од чешће кориштених је

http://www.hprg.com/hapest5/hapest5a/hapest5.htm

Унесите ваше вриједности алела у предиктор и он ће израчунати степен вјероватности којој хаплогрупи припадате. Када унесемо вриједности алела из нашег примјера добићемо резултат да постоји 100% шансе да Y- ДНК припада Р1б хаплогрупи. Не брините ако ваши резултати нису тако чисти процентуално као овај резултат. У случају STR теста ипак се ради о статистичкој вјероватноћи него о апсолутној сигурности одређивања хаплогрупе, за разлику од SNP теста који апсолутно сигурно одређује хаплогрупу. Дакле, ако не можете да одредити са великом вјероватноћом хаплогрупу на основу STR тестирања, требали бисте тестирати SNP.

2) Како да научим више о властитој хаплогрупи?

Након што одредите своју хаплогрупу, требали би да сазнате што више о тој хаплогрупи. Било би добро да знате којој популацији већински припада, која су била њена миграциона кретања у прошлости, гдје је данас највише заступљена, колика је њена процјењена старост. Требали би да сазнате што више о њеним огранцима и подгрупама и да покушате да дефинишете којој подгрупи главне групе припадате. У нашем примјеру видјели смо да је то хаплогрупа R1b. R1b је хаплогрупа која се одвојила од нешто старије хаплогрупе R1, а ова R1 од хаплогрупе R. Данас је хаплогрупа R1b1 најзаступљенија у Западној Европи, међу романским, келтским и германским народима. У Велсу преко 80% становништва припада овој хаплогрупи. Подробније информације о појединим хаплогрупама можете наћи на интернету, а ми ћемо се потрудити да све Y- ДНК хаплогрупе представима и на нашем сајту.

3) Да ли се ико подудара са мојим Y- ДНК хаплотипом?

Да би сазнали што више о нашем хаплотипу и да би потенцијално нашли људе који се генетски подударају са нашим хаплотипом користећемо јавне базе тестираних појединаца од којих је свакако највећа и најрепрезентативнија http://www.ysearch.org/.

У базу y search требали би да унесeте ваш хаплотип, а затим да претражите са ким се подударате у бази, тј. који вам је хаплотип најближи. На тај начин ви можете на основу анализе презимена којима сте најближи да употпуните или дефинишете причу вашег породичног поријекла. Ако је рецимо већина ваших блиских подударања са појединцима из Чешке, Пољске или Русије сасвим је извјесно да сте словенског етничког поријекла. Уколико у бази нађете презимењака са приближно истим резултатима, нема сумње да сте истог поријекла.

SNP тестирање – одређивање хаплогрупе

SNP тестирање тестира појединачни нуклеотид на специфичној локацији на Y хромозому (за разлику од STR тестирања који мјери кратке регионе ДНК). С обзиром да је мутација на појединачној бази много рјеђа у односу на промјене у STR , мушкарци који дијеле СНП обично дијеле претка који је живио много генерација или много стотина генерација уназад. Због овога , СНП се користи да би се идентификовале гране у Y- ДНК породичном стаблу и да би се дефинисале хаплогрупе, као и веома, веома далеко повезани људи. На примјер, људи који се тестирају као позитивни на SNP М207 припадају хаплогрупи R.

Дакле, зашто би се појединци тестирали на СНП? Постоји неколико разлога:

1. Да одреде далеко поријекло – јер има појединаца који су више заинтересованији за далеко поријекло, него да проналазе блиске сроднике.

2. Да сигурно потврде процјењену хаплогрупу – јер, како смо видјели, STR тест може да да процјену хаплогрупе, али не може 100% да је потврди.

3. Да одреди подгрупу главне хаплогрупе – неке хаплогрупе имају неколико подграна које се зову подгрупе или субклади. На примјер хаплогрупа R има подгрупу R1b, а R1b има подгрупе R1b1а и R1b1b . SNP тест може дакле ближе да одреди и којој подгрупи припадате.

Како да тумачимo резултате SNP теста?

Да би протумачили резултате SNP теста добро би било да посјетите страницу http://www.isogg.org/tree/

То је страница Међународног удружења генетске генеалогије и на њој се ажурирају периодично све хаплогрупе и њима припадајуће SNP мутације. Тумачење резултата може да се прикаже на сљедећем примјеру:

Ваша Y-ДНК припада хаплогрупи Е

Ваши SNP резултати су : M96+ P2+ M2- M35+ M78- M183+ M81+ M107- M165- M123-

С обзиром да резултати кажу да припадате хаплогрупи Е можемо на ISOGG страници одмах ићи на Haplogroup E tree

http:////www.isogg.org/tree/ISOGG_HapgrpE.html.

Користимо наше резлтате, почевши са првим SNP М96. Тестирани смо позитивно на М96, што значи да посједујемо ту мутацију. Када погледамо у таблицу видимо да је М96 карактеристичан за хаплогрупу Е. Уназад хиљадама година припадници хаплогрупе Е развили су карактеристичне SNP мутације да би произвели двије гране или подгрупе као што су Е1 и Е2. Наш сљедећи SNP П2+ је карактеристичан за подгрупу Е1б1. Поредећи наш СНП тестирани примјер са стаблом Е хаплогрупе добијамо следећу шему:

M96+ E

P2+ E1b1

M2- E1b1a (не припада овој подгрупи)

M35+ E1b1b1

M78- E1b1b1a (не припада овој подгрупи)

M81+ E1b1b1b

M107- E1b1b1b1 (nе припада овој подгрупи)

M183+ E1b1b1b2

M165- E1b1b1b2a (не припада овој подгрупи)

M123- E1b1b1c (nе припада овој подгрупи)

Закључак је да тестирана Y- ДНК припада подгрупи Е1б1б1б2 (М183) шире хаплогрупе Е.

Процес откривања нових SNP, а самим тим и млађих грана хаплогрупа је стално у току. Сваки новотестирани појединац употпуњује слику велике слагалице поријекла људске врсте. То чини генетичку генеаологију изузетно интересантном и динамичком науком која даје нове одговоре на стара питања и понекад мијења старе ставове.

У наредним текстовима ћемо представити главне хаплогрупе, одговарати на питања везана за генетска тестирања и тумачења резултата и покушати да формирамо базу тестираних појединаца са наших простора. Циљ пројекта је сагледавање историје и поријекла становништва у свјетлу генетских истраживања, као и спој традиционалне и генетске генеаологије.

АУТОР: Сарадник портала Порекло Синиша Јерковић

 

 

Коментари (2)

Одговорите

2 коментара

  1. marijana

    Moja mama se preziva Koldan i svi kazu da je cudno prezime. Pa sam htela da ispunim maminu zelju, zelja joj bila da da zna poreklom prezime i da zna gde ima rodjake u drugim drzavama. Molim vas ako mozete da nekako da nam odgovorite na moje pitanje ili ako ima da se testira.
    A imam i facebook tako mozete da mi odgovorite Marijana Brojcin.

  2. MIODRAG NIKOLIĆ

    SINIŠA URADIO SAM DNA TEST I DOBIO REZULTATE U SARADNJI SA MLADENOM GAJIĆEM . UPUTIO ME NA TEBE . KAŽE DA JE PROSLEDIO MOJE REZULTATE TESTA TEBI . POZDRAV .